1x thermopol reaction buffer (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs 1x thermopol reaction buffer
1x Thermopol Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 2330 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/thermopol+buffer/ThermoPol+Reaction+Buffer/pmc12993374-147-70-74
Average 98 stars, based on 2330 article reviews

1x thermopol reaction buffer - by Bioz Stars, 2026-09

98/100 stars

Images

Polymerase Chain Reaction:

Article Title: Somatic-to-germline transmission of horizontally acquired extrachromosomal circular DNA in Brassica graft chimeras
Article Snippet: .. PCR amplification was performed using either Phanta Max Master Mix (Vazyme) or Taq DNA Polymerase with ThermoPol® Buffer (NEB). .. PCR products were resolved by agarose gel electrophoresis, purified using the E.Z.N.A.® Gel Extraction Kit (Omega), and validated by Sanger sequencing, Illumina-based KBseq or Oxford Nanopore sequencing.

Amplification:

Article Title: Scalable genotyping in fixed transcriptomes resolves clonal heterogeneity via single-cell sequencing
Article Snippet: .. The reaction combines ThermoPol buffer (New England Biolabs) and Flex internal amplification buffer (10x Genomics) to maintain enzymatic performance and downstream compatibility, dNTPs (New England Biolabs) to support complete fill across variable gap lengths (as benchmarked in ), Protector RNase inhibitor (Sigma-Aldrich) to preserve nucleic acid integrity in fixed-cell/nuclei workflows, T4 DNA ligase (New England Biolabs) to stabilize the filled probe junction, and Sulfolobus DNA polymerase IV (New England Biolabs). .. Polymerase selection prioritized the absence of exonuclease and strand displacement activities (screened using the DNA Polymerase Selection Chart; New England Biolabs).

Synthesized:

Article Title: Salt supplementation-induced metabolic reprogramming in Streptomyces coelicolor
Article Snippet: The labeled transcripts were enriched by using hydrophilic streptavidin magnetic beads (NEB) twice, and the 3′ adapter ( TGGAATTCTCGGGTGCCAAGG ) was ligated. .. The enriched transcripts were decapped by RppH (NEB) in a Thermopol Buffer (NEB), and the 5′ adapter ( GUUCAGAGUUCUACAGUCCGACGAUC ) was ligated. cDNA was synthesized by using SuperScript IV (Invitrogen) with the RT primer ( GCCTTGGCACCCGAGAATTCCA ). .. Indexing primers from the TruSeq Small RNA Library Prep Kit (Illumina) and KAPA HiFi HotStart Ready Mix (Roche) were used to amplify the cDNA.

Article Title: Salt supplementation-induced metabolic reprogramming in Streptomyces coelicolor .
Article Snippet: The labeled transcripts were enriched by using hydro philic streptavidin magnetic beads (NEB) twice, and the 3′ adapter (TGGAATTCTCGGG TGCCAAGG) was ligated. .. The enriched transcripts were decapped by RppH (NEB) in a Thermopol Buffer (NEB), and the 5′ adapter (GUUCAGAGUUCUACAGUCCGACGAUC) was ligated. cDNA was synthesized by using SuperScript IV (Invitrogen) with the RT primer (GCCTTGGCACCCGAGAATTCCA). .. Indexing primers from the TruSeq Small RNA Library Prep Kit (Illumina) and KAPA HiFi HotStart Ready Mix (Roche) were used to amplify the cDNA.

Fluorescence:

Article Title: Methods and compositions for nucleic acid amplification
Article Snippet: .. One unit of RNase is defined as the amount of enzyme required to yield a fluorescence signal consistent with the nicking of 100 picomol of synthetic double-stranded DNA (dsDNA) substrate containing a single ribonucleotide near the quencher of a fluorophore/quencher pair in 30 minutes at 37° C. in 1× ThermoPol Buffer (NEB, Inc.). .. The dsDNA substrate can be a 26-mer present at 30 nM in a total reaction volume of 150 μl as indicated in the RNase HII product manual for RNase HII product M0288 of NEB, Inc., and as used to determine unit activity or RNase HII by NEB, Inc. As described in Example 3, the RNase H enzyme concentration used in the RPA amplification reaction can be characterized as a “prohibiting”, “limiting” or “excess” amount.

Review